Pill 44615
Aug 11, 2014 · The pill in question reportedly contains the following active ingredients: 325mgs of Acetaminophen + 200mgs of Guaifenesin + 5mgs of Phenylephrine. According to the Phenylephrine Details and corresponding Wiki page, two of the primary side effects of Phenylephrine are hypertension and an increased heart rate.
Specialties: Dowell Dental Group in Carrollton is led by Stephen C. Dowell, DDS. Our dentist offers general, cosmetic, and restorative dental procedures including dental crowns, Invisalign, dental implants & more. Dr. Stephen C. Dowell has been providing patients with exceptional results using cutting-edge technology in a spa-like environment for over 30 …
340 W Main St Carrollton, OH 44615 Phone (330) 627-5229. Fax (330) 627-3624 08:00 am. 09:00 pm. Hours. ... Pill & refill reminders. Medication journal & mood log.Jan 15, 2004 · *Pill images are for reference only and may not reflect actual size, color and/or markings. **Blister count is per card; multiples of cards there after are available. This product list is proprietary and the property of LNK International, Inc. and is for the exclusive use of only the intended recipient.Carrollton, OH 44615. Sales: 330-427-4613; HUEBNER CHEVROLET. 1155 CANTON RD NW Carrollton, OH 44615. Sales: (330) 476-5008; Huebner Subaru. 1155 Canton Rd. Carrollton, OH 44615. Sales: 330-427-4613; Visit us at: 1155 Canton Road Carrollton, OH 44615. Loading Map... Get in Touch Contact our Sales Department at: 330-427-4613;L484 Pill - white capsule/oblong, 16mm . Pill with imprint L484 is White, Capsule/Oblong and has been identified as Acetaminophen 500mg. It is supplied by Kroger Company. Acetaminophen is used in the treatment of Sciatica; Muscle Pain; Back Pain; Chronic Pain; Pain and belongs to the drug class miscellaneous analgesics.Risk cannot be ruled out during pregnancy.Pill with imprint 44-466 is Green, Capsule/Oblong and has been identified as Acetaminophen and Phenylephrine Hydrochloride 325 mg / 5 mg. It is supplied by Major Pharmaceuticals.Side Effects. Nausea, vomiting, headache, bloating, breast tenderness, swelling of the ankles /feet (fluid retention), or weight change may occur. Vaginal bleeding between periods (spotting) or ...Browse real estate in 44615, OH. There are 40 homes for sale in 44615 with a median listing home price of $120,000. Realtor.com® Real Estate App. 314,000+ Open app. Skip to content. Buy.
AN 415 Pill - orange round, 11mm . Pill with imprint AN 415 is Orange, Round and has been identified as Buprenorphine Hydrochloride and Naloxone Hydrochloride (Sublingual) 8 mg (base) / 2 mg (base). It is supplied by Amneal Pharmaceuticals. Buprenorphine/naloxone is used in the treatment of Opioid Use Disorder and belongs to the drug class narcotic …Browse real estate listings in 44615, Carrollton, OH. There are 49 homes for sale in 44615, Carrollton, OH. Find the perfect home near you.21 Aug 2006 ... 44615–44638. RTTF9R2. CCAGGCATCTGCGCAATCAGG ... a, TraX homologue (F plasmid); b, PilL ... The pilL and pilN genes of Incl1 plasmids. R64 and Collb ...Browse real estate in 44615, OH. There are 40 homes for sale in 44615 with a median listing home price of $120,000.Pill esophagitis usually occurs in the mid esophagus [ 3 ]. This corresponds to areas of extrinsic compression by the mainstem bronchus, aorta, or cardiac atrium where pills or capsules are likely to lodge when swallowed with inadequate volumes of liquid and/or in a supine posture [ 4,5 ].
Id., at 44615–. 44618. The agency believed ... See id., at 44615–44618. The access regulations ... tive sleeping pill (or, say, a kind of popular contact lens),.Discover your next home at Carrollton Crest Apartments. This apartment community is located in Carrollton at 525 Canton Rd. Nw in the 44615 area. From amenities to location, the leasing staff will be ready to help you find your new place. Make sure you to see the available floorplan options. Contact us or drop by to check the current floorplan availability and find your new place at Carrollton ...44 604 Pill - blue oval, 12mm . Pill with imprint 44 604 is Blue, Oval and has been identified as Naproxen Sodium 220 mg. It is supplied by LNK International, Inc. Naproxen is used in the treatment of Back Pain; Ankylosing Spondylitis; Bursitis; Muscle Pain; Chronic Pain and belongs to the drug class Nonsteroidal anti-inflammatory drugs.Risk cannot be ruled out …1. Best Overall Pick — Ezy Dose Pill Cutter and Splitter with Dispenser. Amazon. $2 at Amazon $9 at Walmart. Pill Size: Small and large pills | Pill Capacity: Cuts one pill at a time | Other Features: Portable; stores and dispenses pills | Cost: $2-$9 (Amazon and Walmart) For a general purpose, no-frills pill cutter, the Ezy Dose is our best ...
Netspend ssi deposit dates for september 2023.
Oral contraceptives (OCP) are birth control pills known as hormonal contraceptives or the pill. Their primary purpose is to prevent pregnancy, but they can also help with acne and period problems. OCPs do not prevent sexually transmitted infections (STIs). The cost for birth control usually ranges from $0 to $50.Pill with imprint 44 156 is Orange, Round and has been identified as Phenagesic Acetaminophen 325 mg / Phenyltoloxamine 30 mg. It is supplied by Major Pharmaceuticals Inc. Phenagesic is used in the treatment of Pain; Cold Symptoms; Headache; Influenza and belongs to the drug class analgesic combinations . FDA has not classified the drug for ...Pill Identifier. Results for Sinus. Print. "Sinus" Pill Images. The following drug pill images match your search criteria. Search Results. Search Again. Results 1 - 18 of 60 for " Sinus" Sort by. Results per page. 44615. Multi-Symptom Cold and Sinus. Strength. acetaminophen 325 mg / guaifenesin 200 mg / phenylephrine HCl 5 mg. Imprint. 44615.* Segments = the number of equally sized pieces which the pill can be broken into. In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 42507-251-62: 12 BLISTER PACK IN 1 CARTON (42507‑251‑62) > 2 TABLET, COATED IN 1 BLISTER PACK Active Ingredients:
Jan 8, 2024 · Mucinex Sinus-Max Severe Congestion and Pain: Each caplet contains 325 mg of acetaminophen, 200 mg of guaifenesin, and 5 mg of phenylephrine. Adults and children age 12 years and older: The typical dose is 2 caplets by mouth every 4 hours. Don't take more than 12 caplets in a 24-hour period. Children younger than 12 years old: Ask your child's ...28 Aug 2013 ... Carrollton, OH 44615. Phone: 330-627-9005 ... The Pill Box.. 1400 State Route 125. Amelia ... Pills N' Packages. 49, 53. Plain City Druggist. 41.Pill with imprint 44 588 is Pink, Round and has been identified as Guaifenesin 200 mg. It is supplied by Major Pharmaceuticals. Guaifenesin is used in the treatment of Bronchitis; Bronchiectasis; Cough and belongs to the drug class expectorants . Risk cannot be ruled out during pregnancy. Guaifenesin 200 mg is not a controlled substance under ...In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 41250-465-08 : 2 BLISTER PACK IN 1 CARTON (41250‑465‑08) > 12 TABLET, COATED IN 1 BLISTER PACK4H2 Pill - white oval, 10mm . Pill with imprint 4H2 is White, Oval and has been identified as Cetirizine Hydrochloride 10 mg. It is supplied by Perrigo Company. Cetirizine is used in the treatment of Allergic Rhinitis; Urticaria; Allergies; Food Allergies and belongs to the drug class antihistamines.There is no proven risk in humans during pregnancy.LNK International, Inc. is one of the nation's largest manufacturers of solid and liquid dose, over-the-counter (OTC) pharmaceuticals. For over 38 years, we have built a reputation for delivering the highest quality products, outstanding service and product innovation.Local towns near 44615. This is a list of smaller local towns that surround 44615. If you're planning a road trip or exploring the local area, make sure you check out some of these places to get a feel for the surrounding community. You can also search for cities 100 miles from 44615 (or 50 miles or 30 miles). Pigtown, OH; Washington Hall, OH ...Counterfeit M30 pills containing fentanyl are designed to look almost indistinguishable from the original oxycodone pill. The same large "M" is present on one side with a single line and "30" on the other. The color is also a similar light blue with speckles. The only real discernable difference is the imprints on the pills, with fake ...Enter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results.In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 55312-476-62 : 2 BLISTER PACK IN 1 CARTON (55312‑476‑62) > 12 TABLET IN 1 BLISTER PACKThe lower levels of estrogen in birth control pills suppress FSH and LH, "fooling" the pituitary gland into thinking a woman is pregnant. Ovulation will then not occur, which preve...
In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 11822-0640-8 : 2 BLISTER PACK IN 1 CARTON (11822‑0640‑8) > 12 TABLET, FILM COATED IN 1 BLISTER PACK
His current practice location address is 1196 Kensington Rd Ne, , Carrollton, Ohio and he can be reached out via phone at 330-575-5364 and via fax at 330-627-4076. You can also correspond with Dr. Robert F Miller through mail at his mailing address at 1191 Chase Rd Se, , Carrollton, Ohio - 44615-9619 (mailing address contact number - 330-575 ...Saxenda. How it works: Saxenda (liraglutide), is an injectable medication that reduces food intake by decreasing appetite and increasing feelings of fullness. Effectiveness: A 2016 review found that, after one year, the average user lost between 8.9 pounds and 13.3 pounds.Acetaminophen 325 mg - Phenylephrine HCl 5 mg. Purpose. Pain reliever/fever reducer - Nasal decongestant. Uses. temporarily relieves these symptoms associated with hay fever or other respiratory allergies, and the common cold: minor aches and pains - headache - nasal congestion - sinus congestion and ... Warnings.300 12TH ST NW, Carrollton, OH 44615. 1-2 Beds. Details. 1 Bed, 0 Baths. Contact for Price. 1 Floor Plan. 2 Beds, 0 Baths. Contact for Price. 1 Floor Plan. Apartment for Rent View All Details . All About. Living in Carrollton, OH. Apartments Near 30005 Information.This Honda 44615-HP0-670 HUB fits the following models and components: Aftermarket Parts Drive Wheel Hub. Honda ATV 2006 TRX500TM A - FOURTRAX FOREMAN FRONT WHEEL. Honda ATV 2005 TRX500TM A - FOURTRAX FOREMAN FRONT WHEEL. Description Honda 44615-HP0-670 HUB. Details Placement: FRONT body. Need Help …Search Again. Results 1 - 18 of 120 for " tom". Sort by. Results per page. 44 503. Cold Multi-Symptom Severe. Strength. acetaminophen 325 mg / dextromethorphan 10 mg / guaifenesin 200 mg / phenylephrine 5 mg. Imprint.Satisfaction guaranteed – For questions or comments please call 1-888-287-1915. DISTRIBUTED BY: Walmart Inc.,Bentonville, AR 72716. PRODUCT OF CHINA. *This product is not manufactured or distributed by Johnson & Johnson Corporation, owner of the registered trademark Benadryl® Allergy Ultratabs®. 50844 REV0422B61412. Equate 44-614.* Segments = the number of equally sized pieces which the pill can be broken into. In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 63824-191-16: 16 POUCH IN 1 CARTON (63824‑191‑16) > 2 TABLET, COATED IN 1 POUCH (63824‑191‑72)What L484 Pills Are Used For: Drug Name and Dosage. Each L484 pill is a 500-mg dose of acetaminophen. This is considered an extra-strength dose for an adult, and it's usually taken every four to six hours. Acetaminophen is most commonly used to relieve mild to moderate pain and reduce fever.L461 Pill - orange round, 13mm . Pill with imprint L461 is Orange, Round and has been identified as Ibuprofen (Chewable) 100 mg. It is supplied by McKesson. Ibuprofen is used in the treatment of Chronic Pain; Back Pain; Chronic Myofascial Pain; Aseptic Necrosis; Costochondritis and belongs to the drug class Nonsteroidal anti-inflammatory drugs.prior …
Lantern snow globe cracker barrel.
Conference net rankings.
Atwood Nursing Ctr. Compare Save Share. 347 Steubenville Rd SE, Carrollton, OH 44615. Be the first to write a review. For more information about senior living options: (866) 374-4058. Message.Enter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results.Share. The Algonquin Mill Complex is a collection of original and relocated structures assembled on the grounds around the steam-powered gristmill built circa 1826 and Whispering Winds Farms (circa 1870). The property features traditional outbuildings from the era as well as several 1800's log cabins, an original stage coach inn, a one-room ...Drugs.com provides accurate and independent information on more than 24,000 prescription drugs, over-the-counter medicines and natural products. This material is provided for educational purposes only and is not intended for medical advice, diagnosis or treatment. Data sources include Micromedex (updated 6 May 2024), Cerner Multum™ (updated 6 …Product Dimensions : 12 x 6 x 7 inches; 6.38 ounces. Item model number : 446615. Date First Available : April 16, 2015. Manufacturer : Mr Clean. ASIN : B00W8BMG1K. Best Sellers Rank: #29,411 in Industrial & Scientific ( See Top 100 in Industrial & Scientific) #36 in Mop Refill Sponges.Ortho Flex is a medicare enrolled Supplier in Carrollton, Ohio. It is located at 222 Scio Rd Se, Carrollton, Ohio 44615. You can reach out to the office of Ortho Flex via phone at (330) 627-4446.Ortho Flex supplies medicare equipments and products such as Orthoses: Prefabricated, Orthoses: Off-the-Shelf, Orthoses: Custom Fabricated, Diabetic Shoes & Inserts: Prefabricated, Diabetic Shoes ...Browse real estate listings in 44615, Carrollton, OH. There are 49 homes for sale in 44615, Carrollton, OH. Find the perfect home near you.Dowell Dental Group accepts new patients and offers a great dental experience in Minerva, Dover, Carrollton, OH.See all 1 apartments and houses for rent in 44615, including cheap, affordable, luxury and pet-friendly rentals. View photos, property details and find the perfect listing today.Opill is a progestin-only pill (AKA POPs or mini pills ). Progestin-only pills have one kind of hormone: You guessed it, progestin. Just like mini pills, you must take Opill at the same time every day — within three hours of when you took it the day before. This means you need to take Opill every 24-27 hours to be protected from pregnancy. ….
44615. Radio Shack in Carrollton, OH 44615. Advertisement. 1115 CANTON RD STE F Carrollton, Ohio 44615 (330) 627-1342. Get Directions > 3.9 based on 43 votes. Hours. Hours may fluctuate. For detailed hours of operation, please contact the store directly. Advertisement. Store Location on Map. View Map Use Map Navigation.Enter the imprint code that appears on the pill. Example: L484; Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above. Tip: Search for the imprint first, then refine by color and/or shape if you have too many results.Find patient medical information for diphenhydramine-acetaminophen oral on WebMD including its uses, side effects and safety, interactions, pictures, warnings and user ratings.* Segments = the number of equally sized pieces which the pill can be broken into. In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 63824-191-16: 16 POUCH IN 1 CARTON (63824‑191‑16) > 2 TABLET, COATED IN 1 POUCH (63824‑191‑72)In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 0363-4120-08: 2 BLISTER PACK IN 1 CARTON (0363‑4120‑08) > 12 TABLET, FILM COATED IN 1 BLISTER PACK Active Ingredients: Acetaminophen; ... red pill 44615 acetaminophen and phenylephrine hcl ...Does this pill contain any stimulants like caffeine? Community Discussion: "Hi M A, The pill in question reportedly contains the following active ingredients: 325mgs of Acetaminophen + 200mgs of...Enter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results.1155 CANTON RD NW Directions Carrollton, OH 44615. Home; Shop New New Inventory. All New Chevrolet Inventory Model Year End Event Chevrolet Special Offers Shopper Tools. Payment Calculator Apply for Financing Research Models Chevy Fuel Economy Compare 2.7L vs 5.3L Engines Business Elite SolutionsEnter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results. Pill 44615, Close to Atwood Lake Park, the Pro Football Hall of Fame, and the Utica Shale Rig Sites. Conveniently nestled in the Utica Shale region of Ohio, our Microtel Inn & Suites by Wyndham Carrollton hotel is designed with both business and leisure travelers in mind. Our hotel is 25 miles southeast of Canton and close to the area's oil and gas ..., 20 Sept 2021 ... 44615. 50168. 61362. 64710. 52868. 2019-20 ... iv) Oral Pill users. 15170. M.C.H Activities i ... iv) Oral Pill users. 18421. 2. M.C.H Activities i ..., 44 672 Pill - purple oval, 14mm . Pill with imprint 44 672 is Purple, Oval and has been identified as Diphenhydramine Hydrochloride 25 mg. It is supplied by LNK International, Inc. Diphenhydramine is used in the treatment of Allergic Reactions; Allergic Rhinitis; Cold Symptoms; Allergies; Insomnia and belongs to the drug classes anticholinergic …, Enter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results., Vicks NyQuil VapoCOOL provides maximum strength 9-symptom relief. Vicks NyQuil VapoCOOL nighttime cold medicine helps treat coughing, sneezing, stuffy nose, minor aches and pains, sinus congestion, sinus pressure, sore throat, headache, and fever. Use when you need fast, powerful nighttime relief from your cold symptoms so you can rest., Search Again. Results 1 - 18 of 120 for " tom". Sort by. Results per page. 44 503. Cold Multi-Symptom Severe. Strength. acetaminophen 325 mg / dextromethorphan 10 mg / guaifenesin 200 mg / phenylephrine 5 mg. Imprint., DDM 33 GALLON TRASH BAGS. $28.49 - $29.99 Pampers Diapers, Swaddlers, Active …. $7.49 - $8.49 DDM BABY BACK RIBS CKD. DDM RED PARTY CUP 16 OZ. DDM Allergy Multi-Symptom Cool Tast…. $8.99 - $11.99 DDM Allergy Relief Cetirizine Hydro…. DDM Itch Stopping Cream. DDM Hydrocortisone Ointment 1%., Pill markings play a crucial role in the pharmaceutical industry. They not only provide valuable information about a medication but also ensure quality control. These unique imprin..., Use WebMD's Pill Identifier to find and identify any over-the-counter or prescription drug, pill, or medication by color, shape, or imprint and easily compare pictures of multiple drugs., Members then can choose to pick up their medication at their local CVS Pharmacy ... $ 44,615. $ 45,971. $ 177,526. Gross profit. 6,744. 7,015. 7,492. 7,606., CARROLLTON, OH 44615-9998 Lot Parking Available. For facility accessibility, please call the Post Office. 1-800-ASK-USPS® (800-275-8777) Phone 330-627-2230 Fax 330-627-5308 TTY 330-627-5308. Hours. Bulk Mail Acceptance Hours, Enter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results., Pill with imprint 44-466 is Green, Capsule/Oblong and has been identified as Acetaminophen and Phenylephrine Hydrochloride 325 mg / 5 mg. It is supplied by Major Pharmaceuticals., Carrollton, OH 44615 Hours (330) 627-4446 Also at this address. Adie Tamboli MD. Carrollton Brace & Shoes. Find Related Places. Shoe Store. Clinic. Own this business? Claim it. See a problem? Let us know. You might also like. Drug stores, Hospital equipment and supplies, Veterinarians' instruments and apparatus ..., 745 Pill - pink capsule/oblong, 18mm . Generic Name: diltiazem Pill with imprint 745 is Pink, Capsule/Oblong and has been identified as Tiadylt ER 120 mg. It is supplied by Zydus Pharmaceuticals (USA) Inc. Tiadylt ER is used in the treatment of Angina Pectoris Prophylaxis; Heart Failure; High Blood Pressure and belongs to the drug class calcium channel blockers., A finance expert explains the anti-takeover tool that Twitter hopes will stop Elon Musk's bid to buy the company. Advertisement Takeovers are usually friendly affairs. Corporate ex..., 44-614 Pill - white oval. Pill with imprint 44-614 is White, Oval and has been identified as Diphenhydramine Hydrochloride 25 mg. It is supplied by LNK International, Inc. Diphenhydramine is used in the treatment of Allergic Reactions; Allergic Rhinitis; Cold Symptoms; Allergies; Insomnia and belongs to the drug classes anticholinergic antiemetics, anticholinergic antiparkinson agents ..., 44 334 Pill - white capsule/oblong, 17mm. Pill with imprint 44 334 is White, Capsule/Oblong and has been identified as Extra Strength Headache Relief acetaminophen 250 mg / aspirin 250 mg / caffeine 65 mg. It is supplied by LNK International., Whitepages People Search has contact information for 8 people named Mervin Detweiler across the U.S. We found them in 4 states and 6 cities, including Waynesburg, Carrollton, Carrollton. The top 3 profiles for Mervin Detweiler nearby used to live in Hartly at 6644 Westville Rd, Collbran at 70940 Highway 330 E, Carrollton at 4252 Rush Rd NE., 7 Dec 2021 ... One such burrowing invertebrate. Sphaeroma quoianum (common names: burrowing isopod, Australian isopod, New Zealand pillbug), is a., Rocket Homes › Ohio › Carroll County › Carrollton › 44615. 44615, OH Real Estate Market Overview. Browse 27 homes for sale in 44615, OH. View properties, photos, nearby real estate with school and housing market information. In April 2024 in 44615, OH there were 18.5% more homes for sale than in March 2024., If you don't find any pill images, when using our drug identifier, you can always take the medication to a pharmacist to have them help you identify it. Though this is more time consuming, it will help you identify pills that may be left in your medicine cabinet. If you need to dispose of medications, prescription drop off locations can be ..., Enter the imprint code that appears on the pill. Example: L484 Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above.; Tip: Search for the imprint first, then refine by color and/or shape if you have too many results., Hydrocodone bitartrate and acetaminophen is supplied in tablet form for oral administration. Hydrocodone bitartrate is an opioid analgesic and antitussive and occurs as fine, white crystals or as ... CLINICAL PHARMACOLOGY. Hydrocodone is a semisynthetic narcotic analgesic and antitussive with multiple actions qualitatively similar to those of ..., The following drug pill images match your search criteria. Search Results. Search Again. Results 1 - 4 of 4 for " pill". ALVA. Diurex Water Pills. Strength. caffeine 50 mg / magnesium salicylate 162.5 mg. Imprint., Last updated January 15, 2020. Includes Acetaminophen, Guaifenesin, and Phenylephrine indications, dosage/administration, pharmacology, mechanism/onset/duration of action, half-life, dosage forms, interactions, warnings, adverse reactions, off-label uses and more., Enter the imprint code that appears on the pill. Example: L484; Select the the pill color (optional). Select the shape (optional). Alternatively, search by drug name or NDC code using the fields above. Tip: Search for the imprint first, then refine by color and/or shape if you have too many results., Pill Imprint 44 546. This orange capsule-shape pill with imprint 44 546 on it has been identified as: Cold & cough pe multi-symptom acetaminophen 325 mg / dextromethorphan 10 mg / guaifenesin 100 mg / phenylephrine 5 mg., Real estate highlights in 44615. 44615 housing market. In October 2023, the median listing home price in 44615 was $210K, trending up 13.8% year-over-year. The median listing home price per square ..., Chances are you've heard about - or possibly even tried - the keto diet, a low-carb, high-fat approach to weight loss that is widely popular but not the easiest or most sustainable diet to ..., In this case, a value of 1 indicates a solid pill with no score lines. NDC Package Codes: 42507-419-62 : 12 BLISTER PACK IN 1 CARTON (42507‑419‑62) > 2 TABLET, FILM COATED IN 1 BLISTER PACK, Dayquil Cold and Flu helps treat symptoms from the common cold and flu in adults and children. It can relieve stuffy nose, cough, sore throat, headache, aches, and fever. Besides Dayquil Cold and Flu, this medication is available under many other brand names and as a generic. It's available as pills and a liquid that's typically taken every 4 ..., ZIP Code 44615 is in the Carrollton Exempted Village School District, which serves grades Pre-Kindergarten thru 12th. There are 2 public schools and 1 private schools with a mailing address in the 44615 ZIP Code. ZIP Code 44615 also has 6 universities, colleges or post secondary education institutions nearby which would be a short commute to.